rnascope 2.5 hd singleplex red chromogenic reagent kit Search Results


95
Vector Laboratories immpress hrp peroxidase polymer kit vector laboratories
KEY RESOURCES TABLE
Immpress Hrp Peroxidase Polymer Kit Vector Laboratories, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/immpress hrp peroxidase polymer kit vector laboratories/product/Vector Laboratories
Average 95 stars, based on 1 article reviews
immpress hrp peroxidase polymer kit vector laboratories - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

99
Zymo Research direct zol rna microprep kit
KEY RESOURCES TABLE
Direct Zol Rna Microprep Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/direct zol rna microprep kit/product/Zymo Research
Average 99 stars, based on 1 article reviews
direct zol rna microprep kit - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
Trevigen cometassay kit
KEY RESOURCES TABLE
Cometassay Kit, supplied by Trevigen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cometassay kit/product/Trevigen
Average 95 stars, based on 1 article reviews
cometassay kit - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

86
Bio-Techne corporation lsx rnascope kit
KEY RESOURCES TABLE
Lsx Rnascope Kit, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsx rnascope kit/product/Bio-Techne corporation
Average 86 stars, based on 1 article reviews
lsx rnascope kit - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

97
Qiagen rneasy micro kit qiagen
KEY RESOURCES TABLE
Rneasy Micro Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rneasy micro kit qiagen/product/Qiagen
Average 97 stars, based on 1 article reviews
rneasy micro kit qiagen - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

94
Vector Laboratories immpress excel amplified hrp polymer staining kit
KEY RESOURCES TABLE
Immpress Excel Amplified Hrp Polymer Staining Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/immpress excel amplified hrp polymer staining kit/product/Vector Laboratories
Average 94 stars, based on 1 article reviews
immpress excel amplified hrp polymer staining kit - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Vector Laboratories sk4100 software
KEY RESOURCES TABLE
Sk4100 Software, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sk4100 software/product/Vector Laboratories
Average 96 stars, based on 1 article reviews
sk4100 software - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Advanced Cell Diagnostics Inc rnascope 2.5 duplex assay kit
KEY RESOURCES TABLE
Rnascope 2.5 Duplex Assay Kit, supplied by Advanced Cell Diagnostics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnascope 2.5 duplex assay kit/product/Advanced Cell Diagnostics Inc
Average 90 stars, based on 1 article reviews
rnascope 2.5 duplex assay kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Advanced Cell Diagnostics Inc rnascope probe-mm-amotl2
KEY RESOURCES TABLE
Rnascope Probe Mm Amotl2, supplied by Advanced Cell Diagnostics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnascope probe-mm-amotl2/product/Advanced Cell Diagnostics Inc
Average 90 stars, based on 1 article reviews
rnascope probe-mm-amotl2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

99
Zymo Research direct zol rna miniprep kit zymo research cat
KEY RESOURCES TABLE
Direct Zol Rna Miniprep Kit Zymo Research Cat, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/direct zol rna miniprep kit zymo research cat/product/Zymo Research
Average 99 stars, based on 1 article reviews
direct zol rna miniprep kit zymo research cat - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

99
Thermo Fisher bca protein assay kit pierce
KEY RESOURCES TABLE
Bca Protein Assay Kit Pierce, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bca protein assay kit pierce/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
bca protein assay kit pierce - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
Vector Laboratories acta2 acd 319531 alcian blue stain kit vector laboratories h
KEY RESOURCES TABLE
Acta2 Acd 319531 Alcian Blue Stain Kit Vector Laboratories H, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acta2 acd 319531 alcian blue stain kit vector laboratories h/product/Vector Laboratories
Average 95 stars, based on 1 article reviews
acta2 acd 319531 alcian blue stain kit vector laboratories h - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ™ ) ImmPRESS ™ HRP (Peroxidase) Polymer Kit Vector Laboratories Cat# MP-2400 ImmPACT DAB Peroxidase (HRP) Substrate Vector Laboratories Cat# SK-4105 NE-PER ™ Nuclear and Cytoplasmic Extraction Reagents Thermo Scientific Cat# 78833 DIG RNA Labeling Kit Roche Cat# 11175025910 In Situ Hybridization m Mdm2 probe ACDbio/Biotechne Cat# 447641 RNAscope 2.5 HD Assay kit- BROWN ACDbio/Biotechne Cat# 322310 Super Script VILO cDNA synthesis kit Thermo Scientific Cat# 11754050 RNeasy Mini Kit Qiagen Cat# 74104 SsoAdvance SYBR Green Supermix Biorad Cat# 1725275 BCIP/NBT Color Development Substrate Promega Cat# S3771 Experimental Models: Cell Lines Dih10 The Karin Laboratory ( He et al., 2013 ) N/A DihXY The Karin Laboratory ( He et al., 2010 ; Shalapour et al., 2017 ) N/A Experimental Models: Organisms/Strains Mouse: C57BL/6 Charles River Laboratories Strain Code: 027 Mouse: Cd44 −/− The Jackson Laboratory Stock# 005085 Mouse: p53 F/F Anton Berns ( Budanov and Karin, 2008 ) (Jonkers et al., 2001) N/A Mouse: p21 −/− The Jackson Laboratory Stock# 016565 Mouse: Cd44 F/F This paper, Peter Herrlich (FLI, Germany) N/A Mouse: Albumin-Cre The Jackson Laboratory Stock# 003574 Mouse: EGFR F/F Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: Mx1Cre Maria Sibilia ( Lanaya et al., 2014 ) N/A Mouse: MUP-uPA Eric P. Sandgren ( Weglarz et al., 2000 ) N/A Mouse: Tak1 ΔHep Ekihiro Seki ( Inokuchi et al., 2010 ) N/A Oligonucleotides ChIP Primer, m Cd44 promoter, forward: ATGGGCTGGATTTCCACATA This paper N/A ChIP Primer, m Cd44 promoter, reverse: CCTTTCTCCTCCCAGTCTCC This paper N/A ChIP negative control Primer, m Cd44 promoter, forward: GACTTCTCCCCCTTTTCTGC This paper N/A ChIP negative control Primer, m Cd44 promoter, reverse: GCACCTAACCTTCCCTGGTT This paper N/A ChIP Primer, m c-Fos promoter, forward: TCTGCCTTTCCCGCCTCCCC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m c-Fos promoter, reverse: GGCCGTGGAAACCTGCTGAC ( Kinjyo et al., 2006 ) N/A ChIP Primer, m Gapdh promoter, forward: TTGAGCTAGGACTGGATAAGCAGGG This paper N/A ChIP Primer, m Gapdh promoter, reverse: GTCCGTATTTATAGGAACCCGGATGGTG This paper N/A Primers for analysis of gene-expression changes, see Table S2 The Karin Laboratory N/A Recombinant DNA mCD44 cDNA Open biosystems/Dharmacon Clone ID# 4910789 Cat # MMM1013-202766790 Software and Algorithms GraphPad Prism 7.0 software GraphPad Software, Inc. www.graphpad.com/scientific-software/prism/ R software version 3.3.2 R Foundation for Statistical Computing, Vienna, Austria http://www.r-project.org Image Studio Lite Software LI-COR www.licor.com Adobe Illustrator CS6 Adobe www.adobe.com Open in a separate window KEY RESOURCES TABLE Quantitative Real-Time PCR Analysis RNA samples were prepared using RNeasy kit (Qiagen# 74104).

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software

KEY RESOURCES TABLE

Journal: Developmental cell

Article Title: Myocardial polyploidization creates a barrier to heart regeneration in zebrafish

doi: 10.1016/j.devcel.2018.01.021

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Quantitative real-time PCR RNA from cardiac ventricles or zebrafish larvae was extracted using Trizol reagent (Life Technologies) and the Direct-zol RNA MicroPrep kit (Zymo Research).

Techniques: Recombinant, RNAscope 2.5 HD Assay, TUNEL Assay, In Situ, Clone Assay, Software, Fluorsave, Plasmid Preparation

KEY RESOURCES TABLE

Journal: Cell stem cell

Article Title: Lineage Tracing Reveals a Subset of Reserve Muscle Stem Cells Capable of Clonal Expansion under Stress

doi: 10.1016/j.stem.2019.03.020

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CometAssay® Kit (25 × 2 well slides) , Trevigen , Cat# 4250–050-K.

Techniques: Recombinant, RNAscope, Multiplex Assay, TUNEL Assay, Software

KEY RESOURCES TABLE

Journal: Cancer cell

Article Title: Liver Cancer Initiation Requires p53 Inhibition by CD44-Enhanced Growth Factor Signaling

doi: 10.1016/j.ccell.2018.05.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Vector Labs ImmPRESS ™ Excel Amplified HRP Polymer Staining Kit (MP7601) was used for IHCs that required signal amplification.

Techniques: Recombinant, Blocking Assay, In Situ, TUNEL Assay, Plasmid Preparation, Amplification, Staining, Labeling, In Situ Hybridization, RNAscope 2.5 HD Assay, SYBR Green Assay, Negative Control, Software